under construction3/ adhd helpful nutrients phyto-chemistry
First did a shrink make you ad(h)d by making you belief you have ad(h)d? you have problems, you do not need a psychiatrist, you need results, I have these solutions, you might want to check http://www.resultsproject.net
Think of your childrens' benefit, do they feel happy being labeled? Don't make your child a milk cow for psychiatry, think twice going on with diagnosis who are actually stigmatizing people.
Conservative people notice this: this site is about scientific indications and is scientific., thx for paying attention, now go back to sleep please, you'll do the world a favor.//> Open minded people who think further, please be welcome and continue reading.
Stop going to your shrink or psychologist and spent the money you would give to those dorks on something that makes you feel happy! Go work on you body and condition, get some cool clothes, get anti-depressants from your doctor or better think twice and inform yourself.
Deze site geeft oplossingen voor bepaalde mentale ongemakken die je als mens kan ondervinden zonder tussenkomst van een psychiater of dergelijke kwakzalvers, er worden dingen naar voren gebracht met desbetreffende onderzoeken waar ze goed voor zijn, wat niet altijd te vinden is op het net. Lees de wetenschappelijke artikelen naast de hieronder beschreven producten. U kan last hebben van stress angst concentratie problemen en etc hierbij kunnen onderstaande gegevens u van dienst zijn, bedien u zelve.
Happy Adhd alternatives and also useful for anti anxiety getting happy and less stress.
Basic diet is essential 4 everyone to maintain balance and take a little bit of everything. fruit vegetables enough water meat fish bread etc
4 ad(h)d I recommend these additions
++water
++++++fruit
+++++rhodiola rosea has proven to enhance mental performance, attention span, short-term memory and has many other very healthy properties,ref5 it does that action by increasing the levels of dopamine, noradrenaline, serotonin in the brain which indeed boost up cognitive capabilities[ref6], like concentration,no it's not a stimulant, it's very healhty that's for sure. Rhodiola is not an illegal drug, but a adaptogen, it's available in the local herbstore and is a very good anti-stress agent, I have strong evidence indeed rhodiola is excellent for adhd [ref5][ref6] [ref] [ref2][ref3][ref4]
++++zinc (a reference) (a reference) (onze maatschappij heeft een chronisch zink tekort in onze voeding, genoeg zink en ijzer zijn essentieel voor een goede concentratie)
+++iron (essential for the synthesis of catecholamines like dopamine, serotonin and noradrenalin.)
++++phosphatidyl-serine 300mg - 200mg /d (merk nature-être, memo ps, te koop in carrefour;ook gevonden in soja-lecithine, bepaalde van de stoffen choline inositol en phospatidyl-serine zijn ook te vinden in bepaald combinatie pakketten zie newro zo een ronde pot met 60 pillen speciaal voor de hersenen. Te vinden in biowinkels)(RESULTS In general, PS is suggested to stimulate the dopaminergic system in the hypothalamus)
(a reference)bij deze
dosis zouden adhd symptomen na minimum 4 maanden met 90% dalen.(a reference) phosphatidyl-choline, phosphatidyl-inositol enz
+++++omega 3 gevonden in vette vis, koolzaadolie (alpha-linoleenzuur), voedingssupplementen
(a reference)(a reference)(a reference) (please not the ordinary grocery supplements or the fact omega 3 is put in a number of products it's still not enough, there are big differences between products, lot of bullshit sold today doing the opposite and with too high pcb levels),
good sugg: the Only omega 3 I trust is from minami-nutrition mor-dha + mor-epa ook de (mini) bevat ook teunisbloemolie (GLA) en zou ook goed zijn voor adhd and nordic fish-oil. Niet elk menselijk lichaam is in staat om zelf dha te synteseren, sommige mensen kunnen alleen maar dha opnemen die via de voeding wordt ingenomen, daarom is/kan dha supplementatie essentieel zijn mits zij vooral werkzaam is in de frontale lob en een tekort symptomen à la adhd, depressie, alhzeimer veroorzaakt. De laatste eeuw is de omega 3 met 60% gezakt in de westerse voeding en omega 6 verviervoudigd. (tov19 eeuw)
+++++St-janskruid of hypericum perforatum /een natuurlijk anti-depressief, werkt ook voor adhd vermits zij ook voor een hogere hoeveelheid dopamine en noradrenaline zorgt in de synaptische gleuf, ook in de prefrontale cortex;. (1a reference)(2 a reference,pdf) (3 a reference)(4 a reference) ( 5 a reference pdf) (6 a reference)
+++B-vitamins(suplementatie eerder om een tekort te vermijden)(overdreven supplementatie heeft geen positief effect)
++++guarana (promotes alertness) cafeinestimulant yes for adhd it might work instantly as a mild rilatine replacement.
+++melatonin (eerder voor de nachtrust)(increases IL-1 perhaps due proteine kinase C(a reference) (might increase levels of interleukine-2(a reference)(best taken for sleeping.), melatonine beschermt ook dopimanerge neurons en is tevens een goede anti-oxidant.[ref]
+++knoflook supplementen (increases nitric-oxide levels which are helpful for a healthy bloodflow and helps against vasoconstriction).
+++++ginkgo biloba (excellent to promote a healthy bloodflow to the brain.) (a reference)(a reference)112 patients with chronic cerebral insufficiency received 120 milligrams per day of Ginkgo biloba extract (10).
The researchers found that the use of this extract led to
significant improvements in blood and oxygen flow.
?eleutherococcus senticosus (Siberian ginseng) geen afdoende bewijs dat ginseng enigsinds een positief effect zou hebben inzake onderdrukken van adhd symptomen.
+++++ ginseng panax ginseng soort panax en gingo biloba kan adhd symptomen met 66% laten verminderen binnen de 4 weken volgens deze studie.=>
citaat
++OPC extracten (a reference), (a reference) goeie bloeddoorstroming, gaat gemakkelijk door de bloed-hersenbarrière en
OPC refers to oligomeric proanthocyanidin complexes found in pricy french pine bark extracts like pycnogenol you should not buy; also found in cheaper plants and standardised opc extracts are nowadays sold in bio-shops at lower prices (sugg optimax Procydin). (a reference)
opc zitten ook in ginkgo biloba, etc dus is eigenlijk overbodig indien u dat neemt.
++Echinacea is known to boost the immunesystem due presences of alkylamides and polysacchariden and increase levels of cytokines like il-1 bèta etc.(a reference) and decrease il-2 ( a reference) might be helpful for adhd too. alldue iI sugg.
Alkylamides have also been found to stimulate the production of cytokines such as TNF-alpha and IL-1. These cytokines signal other lymphocytes to actively fight off an infection. Echinacea polysaccharides have also been found to stimulate the immune system by increasing the production of tumor necrosis factor-a (TNF-alpha), and IL-6 by macrophages. ( voor adhd) and their by stimulating dopaminergic neurons due cytokins.
+++Passiflora incarnata (a reference)(a reference)(a reference)(a reference)(a reference)(a reference)(a reference) verkrijgbaar in bioshops en dergelijke.. onschadelijk, weinig of geen neveneffecten, proberen waard als alternatief voor rilatine. je ziet maar.
++++Melissa Officinalis of citroenmelisse (a reference)(a reference) it's calming effect helps for enhancing study time. Intresting is its agonistic effect on nicotine and acetylcholine receptors. Nicotine receptors could also play a role in concentration as well as acetylcholine, which also is involved in concentration and muscle movement.
heeft een beschermende werking op hersenen en verbetert het geheugen.
+++ valeriaan
SOME evidence it has positive effects on hyperactivity and concentration. its action works on gaba receptors like alcohol. does not decrease attention. it's also a sedative and has relaxation anti-anxiety properties. People who have trouble with strong emotions, valeriaan is very good for keeping control over them and feel relaxed! emotional balance
precursor therapy(1)(2): The catecholamines dopamine serotonin noradrenalin epinephrine are syntesized by the body from precursors that could be supplemented; by example d/l-phenylalanin
l-tyrosin could help for adhd too, for example if the body would convert less amino acids who then have to be converted to catecholamines; their would indeed be less or shortage of catecholamines. supplementation would in that case have a huge effect. more information
2
Persoonlijk vraag ik mij sterk af of het al dan niet slikken van voedingssuplementen werkelijk zo gezond is, met mate is denk ik een goede raad en probeer wat combinaties te zoeken die de prijs niet te hoog doen oplopen! Als ik een keuze zou moeten maken uit hierboven zou ik kiezen voor ginko biloba, soja-lecithine of phosphatidyl -inositol -choline - serine, combinatie pakketten bestaan en zijn te vinden in bio winkels vb newro, of producten van biover en etc. Je kan al die dergelijke producten eens uitproberen misschien werkt het voor je, buiten guarana en rhodiola werken veel van die planten niet zoals rilatine maar hebben zij pas na een bepaalde periode een verbetering en op lang termijn ook, voor slaapproblemen is melatonine wel een aanrader, ze halen dat tegenwoordig uit tomaten en is tevens een goede anti-oxidant. Probeer vooral een evenwichtige voeding aan te houden en genoeg te drinken, daarmee heb je normaal gezien al je mineralen en vitamines mee binnen. zink ijzer en magnesium zijn soms een probleem, maar tegenwoordig voegt men die ook gewoon toe aan producten in de supermakt, let er eens op! Ginseng is ook heel positief tegen stress adhd en hebben teven een beschermende werking voor de hersenen en bewezen de combinatie met ginkgo biloba verbetert op termijn de adhd symptomen, rhodiola is tevens een heel gezonde levensverlengende adaptogeen die bijzonder goed is tegen stress en zorgt ook dat neurotransmitters zoals dopamine epinephrine serotonine noradrenaline minder vlug worden afgebroken, een gezond happy plantje.
Waaw allemaal heel duidelijk hoor, wat voor artikelen zijn er zo verkrijgbaar in de winkels?
under construction, examples of products freely available in the Benelux
Discussion
Is er wel sprake van adhd of eerder een nazindering van een stressvolle periode of traumatische ervaring?
Heb ik eigenlijk geen oog problemen bijziend of verziend? Het dragen van overscherpe lenzen verhoogt ook wel de concentratie, vaak weet je ook niet of je ogen wel nog scherp genoeg kunnen focussen je wen geleidelijk aan een troebeler wordend zicht, scherp zien is ook wel handig als je je wilt concentreren op iets.
Heb ik genoeg lichaams beweging?
Ben ik hoogebegaafd? Heb ik last van stressoren uit mijn omgeving die je het leven zuur maken?
non-medicating alternatives for better concentration.
Stop going to your shrink or psychologist and spent the money you would give to those dorks on something that makes you feel happy! A good doctor that you are used to and knows you, can do more than an indoctrinating shrink or psychologist who overbill and tell you lies, do you have adhd?, know that psychiatry is not an exact science and no objective test can prove you are really having a mental illness, only you know how you feel and what makes you happy!
Sharp lenzes or glasses make sure you have a sharp sight and can read far of you, try lenzes from kruidvat or whatever store or go to an eye specialist. - for trouble seeing far + for trouble seeing close by
videogames
Game boy ds lite, play station 2, xbox 360, psp
video games indeed improve attention and concentration due its vividly changing motions and interaction. On Nintendo ds their are also some games meant to exercise the brain like Nintendo brain training.
Computer strooptest.[dep. javascript]
Doing this strooptest does have some positive influence on the brain[ref1][ref2]. http://www.dcity.org/braingames/stroop/
The following aint with mouse but by typing, might be better to use your right hand, edit the letters to example jklm or hjkl leave cancel x and put your fingers on buttons you choose, learn the corresponding colors.
http://www.thewritingpot.com/stroop/
Other games with a positive influence.[dep. java]
http://www.sharpbrains.com/blog/2007/01/29/well-deserved-break-top-10-brain-teasers-2/
Get infected absurd methode have fun! with the Mycobacterium vacae bacteria, which boosts serotonin and noradrenaline supplies. Speaking about friendly bacteria.
http://en.wikipedia.org/wiki/Mycobacterium_vaccae
yoga
stress can find itself a nice coasy place in your body like in your muscles everywere, in the shoulders neck back legs arms stomache, not very convenient. yoga stretches those things out and learns you to be more aware with your body and surroundings training ur muscles at the same time, yoga is also given to children.
By the way sitting behind your computer a lot reading this site, is your back right up or are you sitting potato style? where is your neck? do you have to watch the screen close to read the lettres or can you sit back back right up some distance from the screen???
Magnets on your forehead. absurd methods have fun
!
Many psychiatrists even physicians would shoot me for writing this, but I write it anyway but with some evidence, magnetic field therapy tms is being used for treating depression. I tried it a few times to put some powerful magnets on the forehead, with remarkable results. Putting magnets on your forehead can give you suddenly a lot of concentration or enhanced awareness or makes you go timmy, kind of like taking ritalin and if you place a lot of magnets on your forehead, found in old speakers(never throw with magnets try to dissambly only, hard vibrations degrade magnetism), not the refrigerator magnets, you kind of become happy after a while, really you feel like smiling and all that kind of stuff wiiii. Also a very stunning feeling I encountered putting magnetic fields arround my frontal lobe is stress relief and peacefulness, like less hyperactivity and more ability to sit down and read some book and relax, alldue magnets on forehead is a very old tradition dating from the egyptians, I don't really have the evidence here, to say there is a bigger effect than placebo.. Magnets putt in a head wearing accessory for example. It's kind of true that magnetic fields influence the brain, putting magnetic fields around the frontal lobe might increase or effect the blood flow and electrones within the magnetic field. You do need to have some strong magnets. Seemingly surfing the internet lot of profs studieng brain science put strong electromagnetic fields on their brain to study how the brain actually works, by example putting very strong magnetic fields on the speech area makes you unable to speak, I watched some movies of those profs self under gain that kind of experiments, I think they were quite all right without any bad side effects before and afterwards.
Perfume and aroma's
Experiment with smells you like, perfume your study books or notes, not too much, with a smell that attracts you.
Personally, pushing my neck against my back real tight stretching those muscles attached to the back of your skull so hard that it actually hurts and you hear strange cracking noises while you do that, feels better than ritalin. It makes all the stress glide of your body and it"s better than an orgasm and good for concentration and when you are irritated. Try it, push your head against that back of yours and stretch all those possible muscles and when you are done gentle push your head back forward, thats a real ritalin pill and sometimes better than an orgasm and healthy too, try that;-} ps dont use ur hands while pulling your head back. Om hier even op verder te gaan:ik denk dat veel symptomen die als adhd zijnde toegekend indirect ook gelinkt zijn aan vastgezette stress.
Stress verwijderen, ook al geloof je het niet, sommige lichaamsoefeningen helpen werkelijk goed om je te concentreren of om te relaxeren, zelfs beter! Ik zou niet direct verwijzen naar allerlei alternatieve en pseudo science gedoe, maar het stretchen van nek schouders en rug kan wonderen doen, het is tevens heel positief voor de hersenen! Als je neerzit let op! Rug recht, schouders al dan niet wat achteruit, indien mogelijk hoofd recht[naar achteren. [postuur}
Alles maar met mate is denk ik een goede raad.
Zorg dat je als adhd'er geen tekort aan B-vitamines hebt, zink, ijzer , water, evenwichtige voeding etc. Alle beetjes helpen, dagelijkse mor-epa {mini} supplementatie is aanbevolen voor adhd. Een combinatie van verschillende extracten mits de aanbevolen hoeveelheid, is aangewezen. Voedingssupplementen kosten geld, daarom raad ik aan om een product te kiezen die verschillende extracten combineert. Voorkomend vb ginkgo biloba , phosphatidyl-serine of choline inositol.
Soms is het aangewezen bepaalde extracten appart van elkaar te kopen zoals st-janskruid, passiflora incarnata, mellissa officinalis; niet dat zij onderling elkaar tegenwerken, maar wel dat ze soms verkocht worden in combinatie met andere supplementen die niet gustig zijn voor het concentratievermogen of een sedatieve werking hebben. negatief voor adhdh vb ballota nigra
"informeer u zelf!!!"
Be wise think twice before taking supplements without insurance about the content; Often food supplements contain a number of extracts, be careful, because some might cause the opposite effect and or antagonize one another, an example is ballota nigra, which is not necessarily bad for adhd but might reduce the effect of one another, ballota nigra might help for people with psychosis or people who are very nervous. Most of the things I described only have its effect when taking these supplements for a long time without to many gaps, taking a little from different types of supplements is better than taking high doses of just a few, which can cause the opposite effect, or will not do anything other than emptying your wallet. Look for scientific studies at google why these supplements help. Mensen met een historie van hart- en vaatziekten of een te hoge bloedruk of dergelijke condities onthouden zich beter van supplementen als zij geen dokter raadplegen ook al zouden die een heilzame werking hebben.
Possible consequences or side-effects of increased levels of cytokines etc
Interleukines like il-1, il-2, il-6, tnf-alpha are inflammatory cytokines, which are actively fighting infections, have a wide influence on the brain, like the maturation of dopaminergic neurons. Tnf-alpha induces cell death in malformed or sick cells to foresee the development of possible tumors and there by has anti-cancerogenic properties(a reference). Interleukines also can play a role in the development of rheuma in later life 35+ or ashtma; People who have ashtma, rheuma or any disease involving the immune system should not take these supplements before speaking with your doctor. Alldue supplements like opc's etc have a regulating role and are safe and very healthy, for those people I suggest to be careful.
scientific indications
(for the naggers: indications forthcoming from scientific studies pff, yes indications can be called scientific if they are based upon scientific evidence;stop nagging, start thinking; understanding versus learning is like master versus student like thinks before making claims versus... )
Most of the idea's behind these supplements lie in the hypothesis that adhd symptoms are caused by dopamine and noradrenalin defiency with multi-possible causes linked to these systems. Including the role of the immune system in the development of dopaminergic neurons in the brains of children by interleukine-1(a reference) (a reference) and antagonist Il-1RA and the levels of neurotransmitters(a reference).
a reference
(a referce)(a reference) authors findings[ref]
Too much Catechol-O-methyl transferase[degradation of catecholamines[dopamine,epinephrine, noradrenaline, serotonin]], as a one possible cause for adhd [ref][ref2][ref3][ref4][ref5]
Science indicates people with adhd not necessarily produce less dopamine or their neurons don't produce enough dopamine but are actually normal, what happens is dat the released dopamine is sucked back into the neuron by the DAT transporter before it can actually arrive at the dendrite of the next neuron. It's like we would send our mail, but before it's arrived it's sent back to where it came from. Dopamine reuptake inhibiters work by blocking the dat transporter from sucking the dopamine back into the neuron. Like bupropion[wellbutrin XR], methylphenidatum[ ritalin][ref], very much blocking is what cocain does. etc People who produce too much DAT by their dopaminergic neurons[mostly caused by too may vntr's] will probably have less or not enough dopamine and result in adhd, alldue it's not scientific to make these claims without any notice of evidence, so there are studies pointing out too much Dat transporters can not be the only cause for symptoms like ADHD. { 2 example}
Of course a mutation in the dopamine receptors could also cause symptoms,because then maybe dopamine would not fit or be conceived by the next neuron less efficient. which could also have an effect on behavior, the behavior consequence is not a diagnose or disease, the mutation instead that could cause certain symptoms can be called a diagnose.
Mutations in several dopamine receptor genes are found in people with hyperactivity, an example is a mutation in the drd4 receptor gen, it has many variants.
In the future, psychiatrists will be forced to be more scientific in diagnosing and creating diagnosis, now they are still playing with peoples feet. An example of a scientific diagnose could be: too much Dat transporters being produced by dopamine neurons, let's call it TDTBPBYN DISORDER. By this the diagnose itself would be much closer to the cause of the symptoms people may have, by naming the diagnose after the cause. In the future psychiatrist will have to admit they were stupid, because mental illness is connected to underlying mechanisms in the brain and are much more related to neurology than psychology[also the study of the selfforfilling prophecy} or by the stupidity of psych.
back 2 science:
Lot of people who are hyperactive and have lack of concentration and are diagnosed as adhd have often been found to have too much copies of the gen that transcribes the dopamine transporter 'DAT' and thereby producing too much of this, causing too much dopamine to be reuptaken in the synaps that produced the neurotransmitter. Knocking down the encoded dna that is a rna string that will produce the dat transporter, results in same effects as taking stimulant drugs like ritalin who also block the dat transporter and thereby making those dopaminergic neurons work like they should be in people who would produce too much of those dat transporters, the evidence is an experiment on mouses I present here. [1 rna knockdown experiment ]
The dopamine transporter gen. 1
Vasoconstriction in the brain can cause adhd symptoms like inability to focus on a task, depressed mood, headache etc. Ritalin further worsenes vasoconstriction, that's why I recommend supplements and a good balanced diet with fruit and vegetables to insure a healthy bloodflow to the brain. Anti-dioxydants play an important role in vasodilation, mainly through a mechanism involving increased nitric oxide production etc.
Onderzoek wijst uit dat er een wisselwerking is tussen de hersenen en cytokines(a reference) in beide richtingen en verhoging van cytokines niet noodzakelijk een oorzakelijk verband is van dergelijke symptomen, maar ook een compenserende werking heeft, ook onderling(a reference), men weet dat hoge concentraties Il-2 en IFN-alpha depressieve symptomen kan teweegbrengen(a reference)(a reference) bij intraveneuze behandeling van hepatitis c patienten met ifn-alpha.
Ifn-alpha is een natuurlijk anti-viraal middel dat geproduceerd wordt door macrophagen bij een infectie en heeft ook een weerslag op catecholamines in de hersenen, het verhoogt dan weer de productie van interleukines die dan weer een beter gevoel geven, naast dat ifn-alpha u depressief kan maken dient het in de eerste plaats om virussen te doden en een verdere immuumreactie op gang te brengen, zij zal er voor zorgen dat cytokines de hoogte ingaan en zo een aanval gaan compenseren, interleukines kunnen dan weer de gemoedstoestand verbeteren.
ifn-alpha zorgt er ook voor dat u zich ziek gaat voelen en vermindert dopamine metabolisme in het striatum en de frontale lob, het vermindert de psycho motorische activiteit, wat sterk overeenkomt met het gedrag van mensen dat zich voordoet bij het aanzetten van een bacteriele of virale infectie.
Ifn-alpha vermindert il-1 (a reference), verhoogde il-10 wordt dan weer geassocieerd met anti-depressieve symptomen.. Il-1 is dan weer belangrijk voor de ontwikkeling van het dopaminerge en noradrenerge systeem en heeft een grote invloed op het serotonerge systeem;pfff(a reference)(a reference)..
IL-1 induced the broadest range of neurochemical changes, affecting central norepinephrine (NE), serotonin (5-HT) and dopamine (DA) activity.
il1 verhoogt tryptophaan, serotonine, noradrenaline, dopamine en verhoogt serotonerge transmissie tussen de synapsen.(a reference), Il1RA( A=antagonist) vermindert dan weer de werking van il-1.
IL-2 increased hypothalamic NE turnover (reflecting a profound increase in NE utilization) and enhanced DA turnover in the prefrontal cortex, but did not influence central 5-HT activity
il-6 Peripheral interleukin-6 administration increases extracellular concentrations of serotonin and the evoked release of serotonin in the rat striatum(a reference)(a reference)Il-6 also increases levels of dopamine, but not noradrenalin.
DHA increases NO production by potentiating iNOS expression induced by IL-1
through mechanism involving p44/42 MAPK signalling cascade in rat VSMCs(a reference)
stress reacties;: a reference
Simplified scheme of integrated regulation of the hypothalamic-pituitary-immune axis.
The dna transcription of the dopamine transporter gene;
and obtained these results by copying the gene sequence and make that java script design a proper sirna string?
Hairpin inserts for psiRNA-h7SK G1 (cloning sites: BbsI/BbsI) expression vector
Construct 01 #0 siRNA GC%: 47.62 Position: 2461
Oligo 1
5' ACCTCGCCGTAAATTGAGCGTTCAGTTCAAGAGACTGAACGCTCAATTTACGGCTT 3'
Oligo 2
5' CAAAAAGCCGTAAATTGAGCGTTCAGTCTCTTGAACTGAACGCTCAATTTACGGCG 3'
Construct 01 #0 GC%: 47.62 Position: 2461
siRNA target:
5' GCCGTAAATTGAGCGTTCAGT 3'
siRNA scrambled:
5' GCGGGAGTTCAATCGATACTT 3'
.....................................
Role of hormones in Adhd :
(oestrogeen) estrogene(ref)
positive effects of phyto-estrogens (isoflavonoids)
Think of your childrens' benefit, do they feel happy being labeled? Don't make your child a milk cow for psychiatry, think twice going on with diagnosis who are actually stigmatizing people.
Conservative people notice this: this site is about scientific indications and is scientific., thx for paying attention, now go back to sleep please, you'll do the world a favor.//> Open minded people who think further, please be welcome and continue reading.
Stop going to your shrink or psychologist and spent the money you would give to those dorks on something that makes you feel happy! Go work on you body and condition, get some cool clothes, get anti-depressants from your doctor or better think twice and inform yourself.
Deze site geeft oplossingen voor bepaalde mentale ongemakken die je als mens kan ondervinden zonder tussenkomst van een psychiater of dergelijke kwakzalvers, er worden dingen naar voren gebracht met desbetreffende onderzoeken waar ze goed voor zijn, wat niet altijd te vinden is op het net. Lees de wetenschappelijke artikelen naast de hieronder beschreven producten. U kan last hebben van stress angst concentratie problemen en etc hierbij kunnen onderstaande gegevens u van dienst zijn, bedien u zelve.
Happy Adhd alternatives and also useful for anti anxiety getting happy and less stress.
Basic diet is essential 4 everyone to maintain balance and take a little bit of everything. fruit vegetables enough water meat fish bread etc
4 ad(h)d I recommend these additions
++water
++++++fruit
+++++rhodiola rosea has proven to enhance mental performance, attention span, short-term memory and has many other very healthy properties,ref5 it does that action by increasing the levels of dopamine, noradrenaline, serotonin in the brain which indeed boost up cognitive capabilities[ref6], like concentration,no it's not a stimulant, it's very healhty that's for sure. Rhodiola is not an illegal drug, but a adaptogen, it's available in the local herbstore and is a very good anti-stress agent, I have strong evidence indeed rhodiola is excellent for adhd [ref5][ref6] [ref] [ref2][ref3][ref4]
++++zinc (a reference) (a reference) (onze maatschappij heeft een chronisch zink tekort in onze voeding, genoeg zink en ijzer zijn essentieel voor een goede concentratie)
+++iron (essential for the synthesis of catecholamines like dopamine, serotonin and noradrenalin.)
++++phosphatidyl-serine 300mg - 200mg /d (merk nature-être, memo ps, te koop in carrefour;ook gevonden in soja-lecithine, bepaalde van de stoffen choline inositol en phospatidyl-serine zijn ook te vinden in bepaald combinatie pakketten zie newro zo een ronde pot met 60 pillen speciaal voor de hersenen. Te vinden in biowinkels)(RESULTS In general, PS is suggested to stimulate the dopaminergic system in the hypothalamus)
(a reference)bij deze
dosis zouden adhd symptomen na minimum 4 maanden met 90% dalen.(a reference) phosphatidyl-choline, phosphatidyl-inositol enz
+++++omega 3 gevonden in vette vis, koolzaadolie (alpha-linoleenzuur), voedingssupplementen
(a reference)(a reference)(a reference) (please not the ordinary grocery supplements or the fact omega 3 is put in a number of products it's still not enough, there are big differences between products, lot of bullshit sold today doing the opposite and with too high pcb levels),
good sugg: the Only omega 3 I trust is from minami-nutrition mor-dha + mor-epa ook de (mini) bevat ook teunisbloemolie (GLA) en zou ook goed zijn voor adhd and nordic fish-oil. Niet elk menselijk lichaam is in staat om zelf dha te synteseren, sommige mensen kunnen alleen maar dha opnemen die via de voeding wordt ingenomen, daarom is/kan dha supplementatie essentieel zijn mits zij vooral werkzaam is in de frontale lob en een tekort symptomen à la adhd, depressie, alhzeimer veroorzaakt. De laatste eeuw is de omega 3 met 60% gezakt in de westerse voeding en omega 6 verviervoudigd. (tov19 eeuw)
+++++St-janskruid of hypericum perforatum /een natuurlijk anti-depressief, werkt ook voor adhd vermits zij ook voor een hogere hoeveelheid dopamine en noradrenaline zorgt in de synaptische gleuf, ook in de prefrontale cortex;. (1a reference)(2 a reference,pdf) (3 a reference)(4 a reference) ( 5 a reference pdf) (6 a reference)
+++B-vitamins(suplementatie eerder om een tekort te vermijden)(overdreven supplementatie heeft geen positief effect)
++++guarana (promotes alertness) cafeinestimulant yes for adhd it might work instantly as a mild rilatine replacement.
+++melatonin (eerder voor de nachtrust)(increases IL-1 perhaps due proteine kinase C(a reference) (might increase levels of interleukine-2(a reference)(best taken for sleeping.), melatonine beschermt ook dopimanerge neurons en is tevens een goede anti-oxidant.[ref]
+++knoflook supplementen (increases nitric-oxide levels which are helpful for a healthy bloodflow and helps against vasoconstriction).
+++++ginkgo biloba (excellent to promote a healthy bloodflow to the brain.) (a reference)(a reference)112 patients with chronic cerebral insufficiency received 120 milligrams per day of Ginkgo biloba extract (10).
The researchers found that the use of this extract led to
significant improvements in blood and oxygen flow.
?eleutherococcus senticosus (Siberian ginseng) geen afdoende bewijs dat ginseng enigsinds een positief effect zou hebben inzake onderdrukken van adhd symptomen.
+++++ ginseng panax ginseng soort panax en gingo biloba kan adhd symptomen met 66% laten verminderen binnen de 4 weken volgens deze studie.=>
citaat
These effects can be classified into 3 categories:
nootropic, neurotrophic and neuroprotective. Nootro-
pics are agents that facilitate learning, improve mem-
ory, promote attention, heighten sensory-motor perfor-
mance and stimulate cognitive processing. Ginseng
extracts have been shown to improve memory14,15 and
enhance learning by stimulating activity-dependent
synaptic plasticity.
After 4 weeks(american ginseng(panax) and gingo biloba), the corre-
sponding number of children showing improvement
were 22 (65%) of 34 on hyperactive–impulsive, 18 (53%)
on cognitive problems and 21 (62%) on the oppositional
attribute. In rodent models, ginsenosides havebeen shown to increase dopamine and norepinephrinelevels in the cerebral cortex.18 and
shown to increase brain glucose utilization while
simultaneously reducing lactate and pyruvate, indicat-
ing increased and more efficient aerobic metabolism
within the brain.This may explain whyginseng extract has favourable effects on attention, cog-nitive processing, integrated sensory-motor functionand auditory reaction time in healthy human subjects.19Ginsenosides have been shown to possess neuro-trophic effects. The ginsenosides Rb1 and Rg1 havebeen shown to potentiate the effects of nerve growthfactor, which is a critical endogenous neurotrophicsubstance.20 This suggests that long-term administra-tion of ginseng extract may have the potential to pro-mote the growth of underdeveloped brain regions inthose with ADHD.
nootropic, neurotrophic and neuroprotective. Nootro-
pics are agents that facilitate learning, improve mem-
ory, promote attention, heighten sensory-motor perfor-
mance and stimulate cognitive processing. Ginseng
extracts have been shown to improve memory14,15 and
enhance learning by stimulating activity-dependent
synaptic plasticity.
After 4 weeks(american ginseng(panax) and gingo biloba), the corre-
sponding number of children showing improvement
were 22 (65%) of 34 on hyperactive–impulsive, 18 (53%)
on cognitive problems and 21 (62%) on the oppositional
attribute.
++OPC extracten (a reference), (a reference) goeie bloeddoorstroming, gaat gemakkelijk door de bloed-hersenbarrière en
OPC refers to oligomeric proanthocyanidin complexes found in pricy french pine bark extracts like pycnogenol you should not buy; also found in cheaper plants and standardised opc extracts are nowadays sold in bio-shops at lower prices (sugg optimax Procydin). (a reference)
opc zitten ook in ginkgo biloba, etc dus is eigenlijk overbodig indien u dat neemt.
++Echinacea is known to boost the immunesystem due presences of alkylamides and polysacchariden and increase levels of cytokines like il-1 bèta etc.(a reference) and decrease il-2 ( a reference) might be helpful for adhd too. alldue iI sugg.
Alkylamides have also been found to stimulate the production of cytokines such as TNF-alpha and IL-1. These cytokines signal other lymphocytes to actively fight off an infection. Echinacea polysaccharides have also been found to stimulate the immune system by increasing the production of tumor necrosis factor-a (TNF-alpha), and IL-6 by macrophages. ( voor adhd) and their by stimulating dopaminergic neurons due cytokins.
+++Passiflora incarnata (a reference)(a reference)(a reference)(a reference)(a reference)(a reference)(a reference) verkrijgbaar in bioshops en dergelijke.. onschadelijk, weinig of geen neveneffecten, proberen waard als alternatief voor rilatine. je ziet maar.
++++
heeft een beschermende werking op hersenen en verbetert het geheugen.
+++ valeriaan
precursor therapy(1)(2): The catecholamines dopamine serotonin noradrenalin epinephrine are syntesized by the body from precursors that could be supplemented; by example d/l-phenylalanin
l-tyrosin could help for adhd too, for example if the body would convert less amino acids who then have to be converted to catecholamines; their would indeed be less or shortage of catecholamines. supplementation would in that case have a huge effect. more information
2
Persoonlijk vraag ik mij sterk af of het al dan niet slikken van voedingssuplementen werkelijk zo gezond is, met mate is denk ik een goede raad en probeer wat combinaties te zoeken die de prijs niet te hoog doen oplopen! Als ik een keuze zou moeten maken uit hierboven zou ik kiezen voor ginko biloba, soja-lecithine of phosphatidyl -inositol -choline - serine, combinatie pakketten bestaan en zijn te vinden in bio winkels vb newro, of producten van biover en etc. Je kan al die dergelijke producten eens uitproberen misschien werkt het voor je, buiten guarana en rhodiola werken veel van die planten niet zoals rilatine maar hebben zij pas na een bepaalde periode een verbetering en op lang termijn ook, voor slaapproblemen is melatonine wel een aanrader, ze halen dat tegenwoordig uit tomaten en is tevens een goede anti-oxidant. Probeer vooral een evenwichtige voeding aan te houden en genoeg te drinken, daarmee heb je normaal gezien al je mineralen en vitamines mee binnen. zink ijzer en magnesium zijn soms een probleem, maar tegenwoordig voegt men die ook gewoon toe aan producten in de supermakt, let er eens op! Ginseng is ook heel positief tegen stress adhd en hebben teven een beschermende werking voor de hersenen en bewezen de combinatie met ginkgo biloba verbetert op termijn de adhd symptomen, rhodiola is tevens een heel gezonde levensverlengende adaptogeen die bijzonder goed is tegen stress en zorgt ook dat neurotransmitters zoals dopamine epinephrine serotonine noradrenaline minder vlug worden afgebroken, een gezond happy plantje.
Waaw allemaal heel duidelijk hoor, wat voor artikelen zijn er zo verkrijgbaar in de winkels?
under construction, examples of products freely available in the Benelux
Discussion
Is er wel sprake van adhd of eerder een nazindering van een stressvolle periode of traumatische ervaring?
Heb ik eigenlijk geen oog problemen bijziend of verziend? Het dragen van overscherpe lenzen verhoogt ook wel de concentratie, vaak weet je ook niet of je ogen wel nog scherp genoeg kunnen focussen je wen geleidelijk aan een troebeler wordend zicht, scherp zien is ook wel handig als je je wilt concentreren op iets.
Heb ik genoeg lichaams beweging?
Ben ik hoogebegaafd? Heb ik last van stressoren uit mijn omgeving die je het leven zuur maken?
non-medicating alternatives for better concentration.
Stop going to your shrink or psychologist and spent the money you would give to those dorks on something that makes you feel happy! A good doctor that you are used to and knows you, can do more than an indoctrinating shrink or psychologist who overbill and tell you lies, do you have adhd?, know that psychiatry is not an exact science and no objective test can prove you are really having a mental illness, only you know how you feel and what makes you happy!
Sharp lenzes or glasses make sure you have a sharp sight and can read far of you, try lenzes from kruidvat or whatever store or go to an eye specialist. - for trouble seeing far + for trouble seeing close by
Game boy ds lite, play station 2, xbox 360, psp
video games indeed improve attention and concentration due its vividly changing motions and interaction. On Nintendo ds their are also some games meant to exercise the brain like Nintendo brain training.
Computer strooptest.[dep. javascript]
Doing this strooptest does have some positive influence on the brain[ref1][ref2]. http://www.dcity.org/braingames/stroop/
The following aint with mouse but by typing, might be better to use your right hand, edit the letters to example jklm or hjkl leave cancel x and put your fingers on buttons you choose, learn the corresponding colors.
http://www.thewritingpot.com/stroop/
Other games with a positive influence.[dep. java]
http://www.sharpbrains.com/blog/2007/01/29/well-deserved-break-top-10-brain-teasers-2/
Get infected absurd methode have fun! with the Mycobacterium vacae bacteria, which boosts serotonin and noradrenaline supplies. Speaking about friendly bacteria.
http://en.wikipedia.org/wiki/Mycobacterium_vaccae
yoga
stress can find itself a nice coasy place in your body like in your muscles everywere, in the shoulders neck back legs arms stomache, not very convenient. yoga stretches those things out and learns you to be more aware with your body and surroundings training ur muscles at the same time, yoga is also given to children.
By the way sitting behind your computer a lot reading this site, is your back right up or are you sitting potato style? where is your neck? do you have to watch the screen close to read the lettres or can you sit back back right up some distance from the screen???
Magnets on your forehead. absurd methods have fun
!
Many psychiatrists even physicians would shoot me for writing this, but I write it anyway but with some evidence, magnetic field therapy tms is being used for treating depression. I tried it a few times to put some powerful magnets on the forehead, with remarkable results. Putting magnets on your forehead can give you suddenly a lot of concentration or enhanced awareness or makes you go timmy, kind of like taking ritalin and if you place a lot of magnets on your forehead, found in old speakers(never throw with magnets try to dissambly only, hard vibrations degrade magnetism), not the refrigerator magnets, you kind of become happy after a while, really you feel like smiling and all that kind of stuff wiiii. Also a very stunning feeling I encountered putting magnetic fields arround my frontal lobe is stress relief and peacefulness, like less hyperactivity and more ability to sit down and read some book and relax, alldue magnets on forehead is a very old tradition dating from the egyptians, I don't really have the evidence here, to say there is a bigger effect than placebo.. Magnets putt in a head wearing accessory for example. It's kind of true that magnetic fields influence the brain, putting magnetic fields around the frontal lobe might increase or effect the blood flow and electrones within the magnetic field. You do need to have some strong magnets. Seemingly surfing the internet lot of profs studieng brain science put strong electromagnetic fields on their brain to study how the brain actually works, by example putting very strong magnetic fields on the speech area makes you unable to speak, I watched some movies of those profs self under gain that kind of experiments, I think they were quite all right without any bad side effects before and afterwards.
Perfume and aroma's
Experiment with smells you like, perfume your study books or notes, not too much, with a smell that attracts you.
Personally, pushing my neck against my back real tight stretching those muscles attached to the back of your skull so hard that it actually hurts and you hear strange cracking noises while you do that, feels better than ritalin. It makes all the stress glide of your body and it"s better than an orgasm and good for concentration and when you are irritated. Try it, push your head against that back of yours and stretch all those possible muscles and when you are done gentle push your head back forward, thats a real ritalin pill and sometimes better than an orgasm and healthy too, try that;-} ps dont use ur hands while pulling your head back. Om hier even op verder te gaan:ik denk dat veel symptomen die als adhd zijnde toegekend indirect ook gelinkt zijn aan vastgezette stress.
Stress verwijderen, ook al geloof je het niet, sommige lichaamsoefeningen helpen werkelijk goed om je te concentreren of om te relaxeren, zelfs beter! Ik zou niet direct verwijzen naar allerlei alternatieve en pseudo science gedoe, maar het stretchen van nek schouders en rug kan wonderen doen, het is tevens heel positief voor de hersenen! Als je neerzit let op! Rug recht, schouders al dan niet wat achteruit, indien mogelijk hoofd recht[naar achteren. [postuur}
Alles maar met mate is denk ik een goede raad.
Zorg dat je als adhd'er geen tekort aan B-vitamines hebt, zink, ijzer , water, evenwichtige voeding etc. Alle beetjes helpen, dagelijkse mor-epa {mini} supplementatie is aanbevolen voor adhd. Een combinatie van verschillende extracten mits de aanbevolen hoeveelheid, is aangewezen. Voedingssupplementen kosten geld, daarom raad ik aan om een product te kiezen die verschillende extracten combineert. Voorkomend vb ginkgo biloba
Soms is het aangewezen bepaalde extracten appart van elkaar te kopen zoals st-janskruid, passiflora incarnata, mellissa officinalis; niet dat zij onderling elkaar tegenwerken, maar wel dat ze soms verkocht worden in combinatie met andere supplementen die niet gustig zijn voor het concentratievermogen of een sedatieve werking hebben. negatief voor adhdh vb ballota nigra
Be wise think twice before taking supplements without insurance about the content; Often food supplements contain a number of extracts, be careful, because some might cause the opposite effect and or antagonize one another, an example is ballota nigra, which is not necessarily bad for adhd but might reduce the effect of one another, ballota nigra might help for people with psychosis or people who are very nervous. Most of the things I described only have its effect when taking these supplements for a long time without to many gaps, taking a little from different types of supplements is better than taking high doses of just a few, which can cause the opposite effect, or will not do anything other than emptying your wallet. Look for scientific studies at google why these supplements help. Mensen met een historie van hart- en vaatziekten of een te hoge bloedruk of dergelijke condities onthouden zich beter van supplementen als zij geen dokter raadplegen ook al zouden die een heilzame werking hebben.
Possible consequences or side-effects of increased levels of cytokines etc
Interleukines like il-1, il-2, il-6, tnf-alpha are inflammatory cytokines, which are actively fighting infections, have a wide influence on the brain, like the maturation of dopaminergic neurons. Tnf-alpha induces cell death in malformed or sick cells to foresee the development of possible tumors and there by has anti-cancerogenic properties(a reference). Interleukines also can play a role in the development of rheuma in later life 35+ or ashtma; People who have ashtma, rheuma or any disease involving the immune system should not take these supplements before speaking with your doctor. Alldue supplements like opc's etc have a regulating role and are safe and very healthy, for those people I suggest to be careful.
scientific indications
(for the naggers: indications forthcoming from scientific studies pff, yes indications can be called scientific if they are based upon scientific evidence;stop nagging, start thinking; understanding versus learning is like master versus student like thinks before making claims versus... )
a reference
(a referce)(a reference) authors findings[ref]
Too much Catechol-O-methyl transferase[degradation of catecholamines[dopamine,epinephrine, noradrenaline, serotonin]], as a one possible cause for adhd [ref][ref2][ref3][ref4][ref5]
Science indicates people with adhd not necessarily produce less dopamine or their neurons don't produce enough dopamine but are actually normal, what happens is dat the released dopamine is sucked back into the neuron by the DAT transporter before it can actually arrive at the dendrite of the next neuron. It's like we would send our mail, but before it's arrived it's sent back to where it came from. Dopamine reuptake inhibiters work by blocking the dat transporter from sucking the dopamine back into the neuron. Like bupropion[wellbutrin XR], methylphenidatum[ ritalin][ref], very much blocking is what cocain does. etc People who produce too much DAT by their dopaminergic neurons[mostly caused by too may vntr's] will probably have less or not enough dopamine and result in adhd, alldue it's not scientific to make these claims without any notice of evidence, so there are studies pointing out too much Dat transporters can not be the only cause for symptoms like ADHD. { 2 example}
Of course a mutation in the dopamine receptors could also cause symptoms,because then maybe dopamine would not fit or be conceived by the next neuron less efficient. which could also have an effect on behavior, the behavior consequence is not a diagnose or disease, the mutation instead that could cause certain symptoms can be called a diagnose.
Mutations in several dopamine receptor genes are found in people with hyperactivity, an example is a mutation in the drd4 receptor gen, it has many variants.
In the future, psychiatrists will be forced to be more scientific in diagnosing and creating diagnosis, now they are still playing with peoples feet. An example of a scientific diagnose could be: too much Dat transporters being produced by dopamine neurons, let's call it TDTBPBYN DISORDER. By this the diagnose itself would be much closer to the cause of the symptoms people may have, by naming the diagnose after the cause. In the future psychiatrist will have to admit they were stupid, because mental illness is connected to underlying mechanisms in the brain and are much more related to neurology than psychology[also the study of the selfforfilling prophecy} or by the stupidity of psych.
back 2 science:
Lot of people who are hyperactive and have lack of concentration and are diagnosed as adhd have often been found to have too much copies of the gen that transcribes the dopamine transporter 'DAT' and thereby producing too much of this, causing too much dopamine to be reuptaken in the synaps that produced the neurotransmitter. Knocking down the encoded dna that is a rna string that will produce the dat transporter, results in same effects as taking stimulant drugs like ritalin who also block the dat transporter and thereby making those dopaminergic neurons work like they should be in people who would produce too much of those dat transporters, the evidence is an experiment on mouses I present here. [1 rna knockdown experiment ]
The dopamine transporter gen. 1
Vasoconstriction in the brain can cause adhd symptoms like inability to focus on a task, depressed mood, headache etc. Ritalin further worsenes vasoconstriction, that's why I recommend supplements and a good balanced diet with fruit and vegetables to insure a healthy bloodflow to the brain. Anti-dioxydants play an important role in vasodilation, mainly through a mechanism involving increased nitric oxide production etc.
Onderzoek wijst uit dat er een wisselwerking is tussen de hersenen en cytokines(a reference) in beide richtingen en verhoging van cytokines niet noodzakelijk een oorzakelijk verband is van dergelijke symptomen, maar ook een compenserende werking heeft, ook onderling(a reference), men weet dat hoge concentraties Il-2 en IFN-alpha depressieve symptomen kan teweegbrengen(a reference)(a reference) bij intraveneuze behandeling van hepatitis c patienten met ifn-alpha.
Ifn-alpha is een natuurlijk anti-viraal middel dat geproduceerd wordt door macrophagen bij een infectie en heeft ook een weerslag op catecholamines in de hersenen, het verhoogt dan weer de productie van interleukines die dan weer een beter gevoel geven, naast dat ifn-alpha u depressief kan maken dient het in de eerste plaats om virussen te doden en een verdere immuumreactie op gang te brengen, zij zal er voor zorgen dat cytokines de hoogte ingaan en zo een aanval gaan compenseren, interleukines kunnen dan weer de gemoedstoestand verbeteren.
ifn-alpha zorgt er ook voor dat u zich ziek gaat voelen en vermindert dopamine metabolisme in het striatum en de frontale lob, het vermindert de psycho motorische activiteit, wat sterk overeenkomt met het gedrag van mensen dat zich voordoet bij het aanzetten van een bacteriele of virale infectie.
Ifn-alpha vermindert il-1 (a reference), verhoogde il-10 wordt dan weer geassocieerd met anti-depressieve symptomen.. Il-1 is dan weer belangrijk voor de ontwikkeling van het dopaminerge en noradrenerge systeem en heeft een grote invloed op het serotonerge systeem;pfff(a reference)(a reference)..
IL-1 induced the broadest range of neurochemical changes, affecting central norepinephrine (NE), serotonin (5-HT) and dopamine (DA) activity.
il1 verhoogt tryptophaan, serotonine, noradrenaline, dopamine en verhoogt serotonerge transmissie tussen de synapsen.(a reference), Il1RA( A=antagonist) vermindert dan weer de werking van il-1.
IL-2 increased hypothalamic NE turnover (reflecting a profound increase in NE utilization) and enhanced DA turnover in the prefrontal cortex, but did not influence central 5-HT activity
il-6 Peripheral interleukin-6 administration increases extracellular concentrations of serotonin and the evoked release of serotonin in the rat striatum(a reference)(a reference)Il-6 also increases levels of dopamine, but not noradrenalin.
DHA increases NO production by potentiating iNOS expression induced by IL-1
through mechanism involving p44/42 MAPK signalling cascade in rat VSMCs(a reference)stress reacties;: a reference
Simplified scheme of integrated regulation of the hypothalamic-pituitary-immune axis.
Some major hypothalamic-pituitary effects on immune functions and cross-regulation by immune cell-derived cytokines are shown. Neuromediation of immune functions by neural cells and neural cell activities of immune cytokines are not shown.
Black arrows: release of; green arrows: stimulation or enhancement of expression or release; red arrows: inhibition.
ja eigenlijk nen versimpelde schema van nen interface(communicatie) tussen het immuumsyst en de hersenen. cool maar incompleetThe dna transcription of the dopamine transporter gene;
gene="SLC6A3"source ENSG00000142319
AGACCAAGAGGGAAGAAGCACAGAATTCCTCAACTCCCAGTGTGCCCATGAGTAAGAGCATo find a working sirna sequence I copied the gen above in one of the searches I used at http://www.sirnawizard.com/
AATGCTCCGTGGGACTCATGTCTTCCGTGGTGGCCCCGGCTAAGGAGCCCAATGCCGTGG
GCCCGAAGGAGGTGGAGCTCATCCTTGTCAAGGAGCAGAACGGAGTGCAGCTCACCAGCT
CCACCCTCACCAACCCGCGGCAGAGCCCCGTGGAGGCCCAGGATCGGGAGACCTGGGGCA
AGAAGATCGACTTTCTCCTGTCCGTCATTGGCTTTGCTGTGGACCTGGCCAACGTCTGGC
GGTTCCCCTACCTGTGCTACAAAAATGGTGGCGGTGCCTTCCTGGTCCCCTACCTGCTCT
TCATGGTCATTGCTGGGATGCCACTTTTCTACATGGAGCTGGCCCTCGGCCAGTTCAACA
GGGAAGGGGCCGCTGGTGTCTGGAAGATCTGCCCCATACTGAAAGGTGTGGGCTTCACGG
TCATCCTCATCTCACTGTATGTCGGCTTCTTCTACAACGTCATCATCGCCTGGGCGCTGC
ACTATCTCTTCTCCTCCTTCACCACGGAGCTCCCCTGGATCCACTGCAACAACTCCTGGA
ACAGCCCCAACTGCTCGGATGCCCATCCTGGTGACTCCAGTGGAGACAGCTCGGGCCTCA
ACGACACTTTTGGGACCACACCTGCTGCCGAGTACTTTGAACGTGGCGTGCTGCACCTCC
ACCAGAGCCATGGCATCGACGACCTGGGGCCTCCGCGGTGGCAGCTCACAGCCTGCCTGG
TGCTGGTCATCGTGCTGCTCTACTTCAGCCTCTGGAAGGGCGTGAAGACCTCAGGGAAGG
TGGTATGGATCACAGCCACCATGCCATACGTGGTCCTCACTGCCCTGCTCCTGCGTGGGG
TCACCCTCCCTGGAGCCATAGACGGCATCAGAGCATACCTGAGCGTTGACTTCTACCGGC
TCTGCGAGGCGTCTGTTTGGATTGACGCGGCCACCCAGGTGTGCTTCTCCCTGGGCGTGG
GGTTCGGGGTGCTGATCGCCTTCTCCAGCTACAACAAGTTCACCAACAACTGCTACAGGG
ACGCGATTGTCACCACCTCCATCAACTCCCTGACGAGCTTCTCCTCCGGCTTCGTCGTCT
TCTCCTTCCTGGGGTACATGGCACAGAAGCACAGTGTGCCCATCGGGGACGTGGCCAAGG
ACGGGCCAGGGCTGATCTTCATCATCTACCCGGAAGCCATCGCCACGCTCCCTCTGTCCT
CAGCCTGGGCCGTGGTCTTCTTCATCATGCTGCTCACCCTGGGTATCGACAGCGCCATGG
GTGGTATGGAGTCAGTGATCACCGGGCTCATCGATGAGTTCCAGCTGCTGCACAGACACC
GTGAGCTCTTCACGCTCTTCATCGTCCTGGCGACCTTCCTCCTGTCCCTGTTCTGCGTCA
CCAACGGTGGCATCTACGTCTTCACGCTCCTGGACCATTTTGCAGCCGGCACGTCCATCC
TCTTTGGAGTGCTCATCGAAGCCATCGGAGTGGCCTGGTTCTATGGTGTTGGGCAGTTCA
GCGACGACATCCAGCAGATGACCGGGCAGCGGCCCAGCCTGTACTGGCGGCTGTGCTGGA
AGCTGGTCAGCCCCTGCTTTCTCCTGTTCGTGGTCGTGGTCAGCATTGTGACCTTCAGAC
CCCCCCACTACGGAGCCTACATCTTCCCCGACTGGGCCAACGCGCTGGGCTGGGTCATCG
CCACATCCTCCATGGCCATGGTGCCCATCTATGCGGCCTACAAGTTCTGCAGCCTGCCTG
GGTCCTTTCGAGAGAAACTGGCCTACGCCATTGCACCCGAGAAGGACCGTGAGCTGGTGG
ACAGAGGGGAGGTGCGCCAGTTCACGCTCCGCCACTGGCTCAAGGTGTAGAGGGAGCAGA
GACGAAGACCCCAGGAAGTCATCCTGCAATGGGAGAGACACGAACAAACCAAGGAAATCT
AAGTTTCGAGAGAAAGGAGGGCAACTTCTACTCTTCAACCTCTACTGAAAACACAAACAA
CAAAGCAGAAGACTCCTCTCTTCTGACTGTTTACACCTTTCCGTGCCGGGAGCGCACCTC
GCCGTGTCTTGTGTTGCTGTAATAACGACGTAGATCTGTGCAGCGAGGTCCACCCCGTTG
TTGTCCCTGCAGGGCAGAAAAACGTCTAACTTCATGCTGTCTGTGTGAGGCTCCCTCCCT
CCCTGCTCCCTGCTCCCGGCTCTGAGGCTGCCCCAGGGGCACTGTGTTCTCAGGCGGGGA
TCACGATCCTTGTAGACGCACCTGCTGAGAATCCCCGTGCTCACAGTAGCTTCCTAGACC
ATTTACTTTGCCCATATTAAAAAGCCAAGTGTCCTGCTTGGTTTAGCTGTGCAGAAGGTG
AAATGGAGGAAACCACAAATTCATGCAAAGTCCTTTCCCGATGCGTGGCTCCCAGCAGAG
GCCGTAAATTGAGCGTTCAGTTGACACATTGCACACACAGTCTGTTCAGAGGCATTGGAG
GATGGGGGTCCTGGTATGTCTCACCAGGAAATTCTGTTTATGTTCTTGCAGCAGAGAGAA
ATAAAACTCCTTGAAACCAGCTCAGGCTACTGCCACTCAGGCAGCCTGTGGGTCCTTGCG
GTGTAGGGAACGGCCTGAGAGGAGCGTGTCCTATCCCCGGACGCATGCAGGGCCCCCACA
GGAGCGTGTCCTATCCCCGGACGCATGCAGGGCCCCCACAGGAGCGTGTACTACCCCAGG
ACGCATGCAG
and obtained these results by copying the gene sequence and make that java script design a proper sirna string?
Hairpin inserts for psiRNA-h7SK G1 (cloning sites: BbsI/BbsI) expression vector
Construct 01 #0 siRNA GC%: 47.62 Position: 2461
Oligo 1
5' ACCTCGCCGTAAATTGAGCGTTCAGTTCAAGAGACTGAACGCTCAATTTACGGCTT 3'
Oligo 2
5' CAAAAAGCCGTAAATTGAGCGTTCAGTCTCTTGAACTGAACGCTCAATTTACGGCG 3'
Construct 01 #0 GC%: 47.62 Position: 2461
siRNA target:
5' GCCGTAAATTGAGCGTTCAGT 3'
siRNA scrambled:
5' GCGGGAGTTCAATCGATACTT 3'
.....................................
Role of hormones in Adhd :
(oestrogeen) estrogene(ref)
positive effects of phyto-estrogens (isoflavonoids)
